设为首页收藏本站
开启辅助访问
切换到窄版

 找回密码
 注册

QQ登录

只需一步,快速开始

搜索
查看: 2199|回复: 3

求助序列拼接软件cap3的使用方法以及结果分析

[复制链接]
发表于 2011-4-19 17:00:33 | 显示全部楼层 |阅读模式
如下:23条fasta序列,我想得到一条fasta拼接结果,但是我投进去后,输出我看不懂:希望有人帮下!
>gi|66264939|gb|DR005066.1|DR005066 TC107143 Human placenta, large insert, pCMV expression library Homo sapiens cdna clone TC107143 5' similar to Homo sapiens NIMA (never in mitosis gene a)- related kinase 8 (NEK8), mRNA sequence
GTGGCAGCTGGGCGCACGCANAAGCCGGCGTCACGCGCTCTGGGCGTCTCATCCTGTGGGAGGCCCCACC
CTAGTGCAGGCGGAGGCAGTCTCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCATCTCGCGTTT
CCTGGAGGGCCAGTCGGGTGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCCTGCCTGACT
GACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCCTCACTGACA
TCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGGTGGCCTGTGGGGCCTCTCA
CGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGGGCCGTGGAGACAGCGGCAGACTGGGGCTA
GGCACCAGGGAGTCCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTG
TATGTGGTATCGATTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTT
CAACAAGCTGGGCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCC
CTGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGCACTG
CTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCAATCAGCACGGACAGTTGGG
CACCCATACTCGCCGAGGCAGTCGGGCACCCTGTAAGGTCCAAGGCCTTGAGGGCATCAAG

>gi|14066133|gb|BG755480.1|BG755480 602713853F1 NIH_MGC_48 Homo sapiens cDNA clone IMAGE:4854228 5', mRNA sequence
GCCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGGTGGCCTGTGGGGCCTCTCACGTGCTGGCCC
TGTCCACTGAGCGAGAACTATTTGCCTGGGGCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGA
GTCCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATC
GATTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCCTGAGCTTCAC
ACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGCACTGCTCACTCAGCT
GCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCAATCAGCACGGACAGTTGGGCACCAATACTC
GCCGAGGCAGTCGGGCACCCTGTAAGGTCCAAGGCCTTGAGGGCATCAAGATGGCAATGGTAGCCTGTGG
GGATGCCTTCACTGTAGCTATTGGGGCAGAGAGCGAAGTGTACTCTTGGGGCAAAGGGGCGCGAGGTCGA
TTGGGAACGGAGGGATGAGGATGCCGGACTCCCTCGGCCAGTGCAGTTGGCTGAGACAAACCCTTACACG
GTGACTTTCCGTGTCCTGGTAGCCATGGAAACAACCTCCTGGCTGTTCGATCGGTCACAGATGAAGCCGG
ACCCCCCACTGAGGCACCCGGATACACCTCTGGACCAACCTGATATTGCTTCTCCTCG

>gi|10398276|gb|BE905215.1|BE905215 601499252F1 NIH_MGC_70 Homo sapiens cDNA clone IMAGE:3901117 5', mRNA sequence
ATGGTCGTCAAGATCGGTGATTTCGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCCTACACGGTGG
TGGGTACCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACATCTG
GGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCA
CTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCTATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGC
TGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGCGGCCACCACTCAGCCACATCATGGCACAGCCCCT
CTGCATCCGTGCCCTCCTCAACCTCCACACCGACGTGGGCAGTGTCCGCATGCGGAGGGCAGAGAAGTCC
GTGGCCCCCAGCAACACAGGGAGCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGA
GGCCAGCATCCCACCACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTG
CCAATAGCTCAACACAGAGGTGGTCCAGGTGGCGAGCTTGGGCGCACGCAGAAAGCCGGCCGTCAACGCG
CTCTGGGGCGTCTCATCCTGTGGGGAGGGCCCACCCCTAGGTGCAGGCCGGAGGCAGCTCCTTCCTGGGG
CCAGTGGAGCAGCCCACAGGCCCAGTTCATTCGCGTTTCCTGGGAGGGCCACTCCGGTGTGCCCTTCCAA
CACTGGCTGTTGGGACTTTTTCCTGCTGCCTGCTGCAACGGTCATA

>gi|83048955|gb|DA985607.1|DA985607 DA985607 SYNOV2 Homo sapiens cDNA clone SYNOV2018656 5', mRNA sequence
AAGAAATGAGATGGAGAAGTACGAGCGGATCCGAGTGGTGGGGAGAGGTGCCTTCGGGATTGTGCACCTG
TGCCTGCGAAAGGCTGACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAG
AGCGGCAGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGTACTA
CGAGAACTTCCTGGAAGACAAAGCCCTTATGACCGCCATGGAATATGCACCAGGCGGCACTCTGGCTGAG
TTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCCTGCACTTCTTCGTGCAGATCCTGC
TTGCACTGCATCATGTGCACACCCACCTCATCCTGCACCGAGACCTCAAGACCCAGAACATCCTGCTTGA
CAAACACCGCATGGTCGTCAAGATCGGTGATTTTGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCC
TACACGGTGGTGGGTACCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGA
GTGACATCT

>gi|13287774|gb|BG394326.1|BG394326 602456537F1 NIH_MGC_16 Homo sapiens cDNA clone IMAGE:4578920 5', mRNA sequence
GCCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCGGTGATTTCGG
CATCTCCAAGATCCTTAGCATCAAGAGCAAGGCCTACACGGTGGTGGGTACCCCATGCTATATCTCCCCT
GAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGC
TGGCCAGCCTCAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCAC
CTTTGCACCTATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAG
CCTGCCCAGCGGCCACCACTCAGCCACATCATGGCACAGCCCCTCTGCATCCGTGCCCTCCTCAACCTCC
ACACCGACGTGGGCAGTGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGAGCAG
GACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCCCAACACACTGTCGT
CAGTGTATGCCTGGGGTGGTGGGCTTGGGCGGCCCCCATGGGGATGCCAATGCTCAACACAGAGGTGGTC
CAGGTCGGCAGTGGGGCGCGCGCAGAAGGCGGCGTCACGCGCTACTGGGAGGTCTCAACCTGTGAGCAGG
ACCAACCCCTAAGTGCAAGACGACGCAGACAACCATACTGAGGCACATGGAGCAGCCAAAGCCCAGATTC
AACCGACGAACCAGGGAAGACCAGAACGGGGTGACAATAAAGACGGTCGACAGTGGGGAACCACAACACG
ACGGGCCGAAGGAAAACAAGCACACACCCAAGACAAATCGCGAAGCGACAAACAGGGGGCCAAAGCACGG
CGGCAGCCCCTGAAAACACGAGCCAACACAGGGGACGCGCAACCGCGACAAAACAGGTACACCCCGTACA
AGCAACACCGAAGAAACCGATAGAGAAACAACCAATACGACGACCAACCAGACAGGGTGAAGAGGCAACA
ACACACCAGAGAC

>gi|13136344|gb|BG329906.1|BG329906 602429610F1 NIH_MGC_16 Homo sapiens cDNA clone IMAGE:4559187 5', mRNA sequence
GCCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCGGTGATTTCGG
CATCTCCAAGATCCTTAGCATCAAGAGCAAGGCCTACACGGTGGTGGGTACCCCATGCTATATCTCCCCT
GAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGC
TGGCCAGCCTCAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCAC
CTTTGCACCTATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAG
CCTGCCCAGCGGGCACCACTCAGCCACATCATGGCACAGACCCTCTGCATCCGTGCCCTCCTCAACCTCC
ACACCGACGTGGGCAGAGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGAGCAG
GACCAACAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCCCAACAACACTGTCG
TCAGTGTATGCCTGGGGAGGTGGGCTGGGCACCCCCCTGCGGCTGCAATGCTCAACACAGAGGTGGACCA
GGAGGCAGCTGGGCGCAACGCGAAAGCGGCGTCACGCGCTCATGCGCGTCTCATACTGAGAGGAGGCCCG
ACCCTACGCGCAGGACGAAGCAGACTCCTTACCGAGAGAACGGAAGCAGCCACAGCCCACGTCCAACCGC
GTCCCCGGCAGGA

>gi|68280018|gb|CR986133.1|CR986133 CR986133 RZPD no.9017 Homo sapiens cDNA clone RZPDp9017C1942 5', mRNA sequence
CCATTCACGGTTNGAACCCACGCGCTCCGGGGGCCTCCTCACGCTGCTGGCCCTGTCCACTGAGCGAGAA
CTATTTGCCTGGGGCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCC
AGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCATGATCCT
CACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGGGCCTGGACCACCTCTCC
CTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCCTGAGCTTCACACTACTAGGCTCTGCAC
CCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGG
TGATTGCTACACTTTTGGCAGCAATCANCACGGACAGTTGGGCACCAATACTCGCCGAGGCAGTCGGGCA
CCCTGTAAGGTCCAAGGCCTTGAGGGCATCAAGATGGCAATGGTAGCCTGTGGGGATGCCTTCACTGTAG
CTATTGGGGCAGAGAGCGAAGTGTACTCTTGGGGCAAAGGGGCGCGAGGTCGATTGGGAAGGAGGGATGA
GGATGCCGGACTCCCTCGGCCAGTGCANTTGGATGAGACACACCCTTACACGNTGACTTCCGTGTCCTGN
TGCCATGGAAACACCCTCCTGACTGTTCNATCGGNCACANATGAACCCGGTCCCCCCCCTGAANGCACCC
GGAATTCACCTCCTGGACCACCCCTGATATTGCTTCTCCCT

>gi|67869303|gb|DR157143.1|DR157143 HESC2_74_D03.g1_A035 NIH_MGC_258 Homo sapiens cDNA clone IMAGE:7965824 5', mRNA sequence
CACTCCCACAGCAGTGCCCAGATCCCCGACACAATGGAGTGAGCGAAGGAGACGAGCAGGATTGTGCCAG
CGCCAGGATTGTGCACCTGTGCCTGCGAAAGGCTGACCAGAGGCTGGTGATCATCAAGCAGATTCCAGTG
GAACAGATGACCAAGGAAGAGCGGCAGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACC
CCAATGTCATTGAGTACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACC
AGGCGGCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCCTGCAC
TTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGCACCGAGACCTCAAGA
CCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCGGTGATTTCGGCATCTCCAAGATCCT
TAGCAGCAAGAGCAAGGCCTACACGGTGGTGGGTACGCCATGCTATATCTCCCCTGAGCTGTGTGAGGGC
AAGCCCTACAACCGGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGA
GGGCTTTCGAGGC

>gi|12100343|gb|BF795289.1|BF795289 602256258F1 NIH_MGC_85 Homo sapiens cDNA clone IMAGE:4339527 5', mRNA sequence
GACTGACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCCTCACT
GACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGGTGGCCTGTGGGGCCT
CTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGGGCCGTGGAGACAGCGGCAGACTGGG
GCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGA
GTTGTATGTGGTATCGATTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACA
GGTTCAACAAGCTGGGCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGA
GGCCCTGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGC
ACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCAATCAGCACGGACAGT
TGGGCACCAATACTCGCCGAGGCAGTCGGGCACCTGTAAGGTCCACGGCCTTGAGGGCATCAAGATGGCA
ATGGTAGCTGTGGGGATGCCTTCCCTGTAGCTATGGGGCAGAGAGCGAAGTGTACTCTTAGGGGGAAACG
GGGCGCGAAGGTCAATTGGGAACGCACGGGCTCCGCTGCCGGACTCCTCGCCAGCGCAGTGGATGAGGCA
CACCTTACACGGTGACTCCGGGCCCGGTGGCATGGAAGACCCCACGGAGGTCACACGGGCCACAGAGTAA
GCGGCCCCCTAGGAACCGGAGTGTACCACTGGGACACCCGGAGAATGGCTACTGCACACAAAGCGCGTGA
ACGAGGCGACGGACAAGGGCGAACTAGCTAAGATCCGAACGAGCACACAAGCGACAGAGGAGGACACCCA
GAGCTACAGCCAGTAGCACCACACAGCTCCACAACGCAACAACCTTCAAGAAAGAAGAACACGTAAGAAC
AAACAACAACGCCACAAAAGAGCGACCACAAGTAGTGGGCGTGTCTAGCCGCTATTCACACAAAACAGAA
AC

>gi|22838601|gb|BU528160.1|BU528160 AGENCOURT_10188187 NIH_MGC_101 Homo sapiens cDNA clone IMAGE:6538071 5', mRNA sequence
AACAATTGTCGGTTTCTCGGGTTCTCTCTCTCTCTCTCTCTGTCTCTCTGTCTCTCTGGGGCCGTGGAGA
CAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGA
CAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAG
CCTGTGGGAGCAACAGGTTCAACAAGCTGGGCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCA
CCAGCAAGTGGAGGAGGCCCTGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTG
AGTATAGACCTGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCA
ATCAGCACGGACAGTTGGGCACCAATACTCGCCGAGGCAGTCGGGCACCCTGTAAGGTCCAAGGCCTTGA
GGGCATCAAGATGGCAATGGTAGCCTGTGGGGATGCCTTCACTGTAGCTATTGGGGCAGAGAGCGAAGTG
TACTCTTGGGGCAAAGGGGCGCGAGGTCGATTGGGGAGGAGGGATGAGGATGCCGGACTCCCTCGGCCAG
TGCAGTTGGATGAGACACACCCTTACACGGTGACTTCCGTGTCCTGTTTGCATGGAAACACCCTCCTGGC
TGTTCGATCGGTCACAGATGAGCCGGTCCCCCCCTGAAGAACCCCGATTCACCTCTGGACCCACCCTGAA
ATTGCTTCTCCTCTGAATGCTCTGAAAAATGCAGGGGCCCAAAGCATGACTTGCAGCTGTCTCCTGGAAT
GNGGCCATCATGGGGGTATCAAGGGCTGGGAAAAACCCTGCCTCTGCTTTTTGCGCCTTGGATATGGAAA
ACCTCCC

>gi|9806475|gb|BE562755.1|BE562755 601336045F1 NIH_MGC_44 Homo sapiens cDNA clone IMAGE:3689963 5', mRNA sequence
ACAATGGAGTGAGCGAAGGAGACGAGCAGGTTGTGCCAGCGCCAGGTGCTGCAGTGAGGTCGGCGCGCAC
GTGCACGGGATTGTGCACCTGTGCCTGCGAAAGGCTGACCAGAATCTGGTGATCATCAAGCAGATTCCAG
TGGAACATGATGACCAAGGAAGAGCGGCAGGCATGCCCAGAATGAGTTGCCAGGTCCTCAAGCTGCTCAA
CAGCCCCAATGTCATTGAGTACTATCGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATA
TGCACCAGGCGGTCACTCTGGCTGAGATTCGAATCCAAAAGCGCTGTAATTCCCTGCCTGGAGGAGGAGA
CCATCCTGCACTTCTTCGTGCAGATCCTGCTTGACACTGCATCATGTGCACAGCCAGGCTCATCCTGCAG
GCGATGACTCAAGATCCCAGAACATCCTGCTTGTAGCAAAGCACCGCATGGTCGTCGAAGGATCGGTGAT
TTCTGGCATCTCCAAGATCCTTAGACAGCAAGAGCAAGGCTACACGGTGGTGGGTACCCCATGCTATATC
TCCCCTGAGCTGTGTGAGGGCACAGCCCTACAAGCAGAAGAGTGACATCTGTGGCCCTGGGGCTGTGTCC
TCTACGACGCTGGCCAGCCTCCATGATGGCTTTCGAGGGCTTGCGAGCCTTGCCAGCACTTGGTGCTGAG
CGATCATTGAGTGGGCCTTTGCACTATTCTCTGACCGGTACAGCCTGAGCTTCGCCGGTGGTCTGAGTCT
ACTCCAGGCTTGGGGCTGCCAGGGGCACACCACTCGGCCCATCTTGGCGGCCCTCTGCTTCCGGCCTCTC
ACTCCACACCGCGTGGGGGAGCCGCTTGGGCGCCTGTGTGCCGGCGCGGCT

>gi|92212888|gb|DB499090.1|DB499090 DB499090 RIKEN full-length enriched human cDNA library, hypothalamus Homo sapiens cDNA clone H033072A16 5', mRNA sequence
GGGAGTGAAACTCTAAGAAATGAGATGGAGAAGTACGAGCGGATCCGAGTGGTGGGGAGAGGTGCCTTCG
GGATTGTGCACGTGTGCCTGCGAAAGGCTGACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACA
GATGACCAAGGAAGAGCGGCAGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAAT
GTCATTGAGTACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCG
GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCCTGCACTTCTT
CGTGCAGATCCTGCTCGCACTGCATCATGTGCACACCCACCTCATCCTGCACCGAGACCTCAAGACCCAG
AACATCCTGCTTGACAAACACCGCGTGGTCGTCAAGATCGGTGATTTCGGCATCTCCAA

>gi|46566216|gb|CN484712.1|CN484712 hx17d11.y1 Human primary human ocular pericytes. Equalized (hx) Homo sapiens cDNA clone hx17d11 5', mRNA sequence
CCAGTGGGAGCACAGGAGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGG
GAGCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCCCACCACCA
CTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTGCCAATGCTCAACACAGAGG
TGGTCCAGGTGGCAGCTGGGCGCACGCAGAAAGCCGGCGTCACGCGCTCTGGGCGTCTCATCCTGTGGGA
GGCCCCACCCCTAGGTGCAGGCGGAGGCAGTCTCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTC
ATCTCGCGTTTCCTGGAGGGCCAGTCGGGCGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTG
CCTGCCTGACTGACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAG
CCTCACTGACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGGTGGCCTGT
GGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGA

>gi|47310027|gb|CN293613.1|CN293613 17000600172170 GRN_PREHEP Homo sapiens cDNA 5', mRNA sequence
GGAGAAGTACGAGCGGATCCGAGTGGTGGGGAGAGGTGCCTTCGGGATTGTGCACCTGTGCCTGCGAAAG
GCTGACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGCAGGCAG
CCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGTACTACGAGAACTTCCT
GGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCGGCACTCTGGCTGAGTTCATCCAAAAG
CGCTGTAATTCCCTGCTGGAGGAGGAGACCATCCTGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATC
ATGTGCACACCCACCTCATCCTGCACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCAT
GGTCGTCAAGATCGGTGGTGGGTACCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAA
CCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAA

>gi|12385147|gb|BF982335.1|BF982335 602306439F1 NIH_MGC_88 Homo sapiens cDNA clone IMAGE:4397768 5', mRNA sequence
CGACACAATGGAGTGAGCGAAGGAGACGAGCAGGTTGTGCCAGCGCCAGGTGCGCAGGGGGTCGGCGCGC
ACGTGCACGGGATTGTGCACCTGTGCCTGCGAAAGGCTGACCAGAAGCTGGTGATCATCAAGCAGATTCC
AGTGGAACAGATGACCAAGGAAGAGCGGCAGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAAA
CACCCCAATGTCATTGAGTACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATG
CACCAGGCGGCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCCT
GCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGCACCGAGACCTC
AAGAACCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCGGTGATTTCGGCATCTCCAAGA
TCCTTAGCAGCAAGAGCAAGGCTACACGGTGCCTGGGCATGGAAGGGACCTCCAGGGCACTAGAAGTCTT
GAGGGCCAGGACTAAACCTGACTCCTCACATCACGCTAAAAAACCTTGGCCCTTTGGCCCCTGTAGGGTG
GTACTGCAGGAGGAAGCCCCTTGGATTGCTTTGAGACGAAGCTGGTCCAACATGGGTTAATGCCCAGAAG
CCCAGAGTCCTACCACACCTGGACGCAGTCGGGATCCCAGTAATATTCCGGCAGGAAGAGGGGACACCAG
GGAAAAACGTCCCAGACACGCAGAATAAGGAACGGCTAGAAACGAAAGAGAGACACGGCCAGACGGGCAC
AAAAATGGGCAGCCACAGAAGGAAAGGCAGACATCTGACAACAGCGCAAAAAAACAACGGACATGAAACC
ATAAGACGAAAACGAAACGAAGGCAAAAAACCAGAAAACAGCGAAAAGAAAGAGAACAAATCAACACCAC
AAAGCAAGAAGGACAAGAAGAAGAACGAACAAAGCGAAGACACATAGTGAAGAAGCCACAAAACCTAAAC
AA

>gi|28848021|gb|BX283567.1|BX283567 BX283567 NIH_MGC_48 Homo sapiens cDNA clone IMAGp958I131701 ; IMAGE:4854228 5', mRNA sequence
GCCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGGTGGCCTGTGGGGCCTCTCACGTGCTGGCCC
TGTCCACTGAGCGAGAACTATTTGCCTGGGGCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGA
GTCCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATC
GATTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCCTGAGCTTCAC
ACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGCACTGCTCACTCAGCT
GCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCAATCAGCACGGACAGTTGGGCACCAATACTC
GCCGAGGCAGTCGGGCA

>gi|51661225|gb|CR747570.1|CR747570 CR747570 NIH_MGC_88 Homo sapiens cDNA clone IMAGp998N0910098 ; IMAGE:4397768 5', mRNA sequence
CCACGCGTCCGCGACACAATGGAGTGAGCGAAGGAGACGAGCAGGTTGTGCCAGCGCCAGGTGCGCAGGG
GGTCGGCGCGCACGTGCACGGGATTGTGCACCTGTGCCTGCGAAAGGCTGACCAGAAGCTGGTGATCATC
AAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGCAGGCAGCCCAGAATGAGTGCCAGGTCCTCA
AGCTGCTCAACCACCCCAATGTCATTGAGTACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGC
CATGGAATATGCACCAGGCGGCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAG
GAGACCATCCTGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGC
ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCGGTGATTTCGG
CATCTCCA

>gi|6896601|gb|AW391942.1|AW391942 QV4-ST0234-121199-032-c04 ST0234 Homo sapiens cDNA, mRNA sequence
TGTAGTACCAACTGGCGCTAGGCTCAAGGAGTCCCACAGCTGCCCCAGCAGGTGCCCATGCCCCCAGGAC
AGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCATGATCCTCACTGTGCCTGTGCAAGCCCTAGC
CTGTGGGAGCAACAGGTTCAACAAGGCTGGGCCTGGTACCACTCTCCCTGGGGGAGGAGCCTGTCCCCCA
TCAGCAAGTGGAGGAGGCCCTGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTG
AGTATAGACCTGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACACTTTTGGCAGCA
ATCAGCACGGACAGTTGGGCACCAATACTCGCCGAGGCAGTCGGGCACCCTGTAAGGTCCAAGGCCTTGA
GGGCATCAAGATGGCCATGGTAGCCTGTGGGGATGCCTTCACTGTAGCTATTGGGGCAGAGAGCGAAGTG
TACTCTTGGGTACTACGCTTTGGGCAC

>gi|71054955|gb|DR762255.1|DR762255 HESC4_138_C04.g1_A037 NIH_MGC_262 Homo sapiens cDNA clone IMAGE:7971922 5', mRNA sequence
TGAGGGCAGCCCTACACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCT
CAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCT
ATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGC
GGCCACCACTCAGCCACATCATGGCACAGCCCCTCTGCATCTGTGCCCTCCTCAACCTCCACACCGACGT
GGGCAGTGTCCGCATGCGGAGGCCTGTGCAGGGACAGCGAGCGGTCCTGGGCGGCAGGGTGTGGGCACCC
AGTGGGAGCACAGGAGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGA
GCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCCCACCACCACT
GTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTGCCAATGCTCAACACAGAGGTG
GTCCAGGTGGCAGCTGGGCGCACGCAGAAAGCCGGCGTCACGCGCTCTGGGCGTCTCATCCTGTGGGAGG
CCCCACCCCTAGGTGCAGGCGGAGGCAGTCTCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCAT
CTCGCGTTTCCTGGAGGGCCAGTCGGGTGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCC
TGCCTGACTGAC

>gi|3425288|gb|AI086865.1|AI086865 oz86d02.x1 Soares_senescent_fibroblasts_NbHSF Homo sapiens cDNA clone IMAGE:1682211 3' similar to WP:ZC581.1 CE15235 SER/THR-PROTEIN KINASE ;contains Alu repetitive element;contains element LTR1 LTR1 repetitive element ;, mRNA sequence
TTTTTTGTATTTTTAGTAGAGACGGGGTTTCCCCGTGTTAAACAGGATGGTCTCGATCTCCTGACCTCAT
GATCCGCCCGCCTCGGCGTTGGCCTCCCAAAGTGCTGAGATTACAGGCATGAGCCACCGTGCCCAGCCAA
CAACCCCTCTCCTTTTATGTATGGAACAGGGCACTGGGACCAGAGAGGACAAGGGGCTAGCCGGGGTCAG
ATAATTGGGACCAGAACTCTAACCCTTGGCCATGCCCATTCCAAGGAGGGAAGCCAGGAGATTTGTGTCT
GCCTGTCCCAGAGGTAAGAGGCCCTCCAGCCAGGCCACTGTAAGGAGGCTGGCCCACCTGGTGCATATTC
CATGGCGATCATAAGGGCTTTGTCTTCCAGGAAGTTCTCGTAGTACTCAATGACATTGGGGTGGTTGAGC
AGCTTGAGGACCTGGCACTCATTCTGGGCTGCCTGCCGCTCTTCCTTGGTCATCTGTTCCACTGGAATCT
GCTTGATGATCACCAGCTTCTGGTCAGCCTTTCGCAGGCACAGGTGCACAATCCCGAAAGCACCTCTTCC
CACCACTCGGATCCGCTCGTACTTCTCCAT

>gi|2007915|gb|AA355597.1|AA355597 EST64022 Jurkat T-cells VI Homo sapiens cDNA 5' end, mRNA sequence
CCCACAGCTGCCCCCAGCAGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGA
TTCCTCCATGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGGGC
CTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCCTGAGCTTCACAC
TACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACCTGGGCACTGCTCACTCAGCTGN
TGTGACTGCCTCGGGTGATTNCTACAACTTTTTGGCAGCAATNAGCAACGGACAGTTTGGGCACCAATTA

>gi|14806750|gb|BI254389.1|BI254389 602976703F1 NIH_MGC_12 Homo sapiens cDNA clone IMAGE:5116008 5', mRNA sequence
CACAGAGCCCCTGGTCTTCCCTCCCTGCAGGCTGTGATCCCAGCTTCTATCCTGCAGGATAGAAGCTGGG
ATCACAGCTTCTATCCTGCAGGTGGTGGGTACCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGC
CCTACAACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGC
TTTCGAGGCAGAGGTGAGTGTATGCACCCTCCAGGGGACAACTGAGAAATCTACTGCCTCGCCCAGCAGC
CCTTGGCTCAAGCCACCTCAGGTTTCTCCTCTAGACTGAGTCATGTCTCTCCCTTATCAGATTACCCCAG
GGGAGGGCTATGGGTGTCCCTCAGACTATGGATATCTGAGAGTAGGTCTTGCCTCCCATTAGACTGGAGG
GCTCCTGAGCGGCAGGGCTGTGGCTTTCCCAGAAGACCCTCCCAAGATGCAAGACTTGAGTTATCCCAGC
ATGCTGCGGTTTCTGACGGATATAGCTGCAGCTCCCCTATCAGACTAGGGATC

>gi|109407925|gb|EC443902.1|EC443902 233005_1308_1119 LNCAP + R1881 synthetic Androgen human prostate library Homo sapiens cDNA similar to ENSG00000160602|ENST00000268766, mRNA sequence
GTTCCACTGGAATCTGCTTGATGATCACCAGCTTCTGGTCAGCCTTTCGCAGGCACAGGTGCACAATCCT
GAAGAGGACATGACACGGTC



得到的结果:
Number of segment pairs = 506; number of pairwise comparisons = 108
'+' means given segment; '-' means reverse complement

Overlaps            Containments  No. of Constraints Supporting Overlap

******************* Contig 1 ********************
gi|51661225|gb|CR747570.1|CR747570+
gi|92212888|gb|DB499090.1|DB499090+
gi|83048955|gb|DA985607.1|DA985607+
gi|67869303|gb|DR157143.1|DR157143+
gi|13287774|gb|BG394326.1|BG394326+
                    gi|10398276|gb|BE905215.1|BE905215+ is in gi|13287774|gb|BG394326.1|BG394326+
                    gi|13136344|gb|BG329906.1|BG329906+ is in gi|13287774|gb|BG394326.1|BG394326+
******************* Contig 2 ********************
gi|71054955|gb|DR762255.1|DR762255+
gi|46566216|gb|CN484712.1|CN484712+
gi|66264939|gb|DR005066.1|DR005066+
gi|12100343|gb|BF795289.1|BF795289+
                    gi|68280018|gb|CR986133.1|CR986133+ is in gi|12100343|gb|BF795289.1|BF795289+
                    gi|14066133|gb|BG755480.1|BG755480+ is in gi|12100343|gb|BF795289.1|BF795289+
                    gi|2007915|gb|AA355597.1|AA355597+ is in gi|14066133|gb|BG755480.1|BG755480+
                    gi|28848021|gb|BX283567.1|BX283567+ is in gi|14066133|gb|BG755480.1|BG755480+

DETAILED DISPLAY OF CONTIGS
******************* Contig 1 ********************
                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ CCACGCGTCCGCGACACAATGGAGTGAGCGAAGGAGACGAGCAGGTTGTGCCAGCGCCAG
                      ____________________________________________________________
consensus             CCACGCGTCCGCGACACAATGGAGTGAGCGAAGGAGACGAGCAGGTTGTGCCAGCGCCAG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ GTGCGCAGGGGGTCGGCGCGCACGTGCACGGGATTGTGCACCTGTGCCTGCGAAAGGCTG
gi|92212888|gb|DB499+                             CGGGATTGTGCACGTGTGCCTGCGAAAGGCTG
gi|83048955|gb|DA985+                             CGGGATTGTGCACCTGTGCCTGCGAAAGGCTG
gi|67869303|gb|DR157+                               GGATTGTGCACCTGTGCCTGCGAAAGGCTG
                      ____________________________________________________________
consensus             GTGCGCAGGGGGTCGGCGCGCACGTGCACGGGATTGTGCACCTGTGCCTGCGAAAGGCTG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ ACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGC
gi|92212888|gb|DB499+ ACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGC
gi|83048955|gb|DA985+ ACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGC
gi|67869303|gb|DR157+ ACCAGAGGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGC
                      ____________________________________________________________
consensus             ACCAGAAGCTGGTGATCATCAAGCAGATTCCAGTGGAACAGATGACCAAGGAAGAGCGGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ AGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGT
gi|92212888|gb|DB499+ AGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGT
gi|83048955|gb|DA985+ AGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGT
gi|67869303|gb|DR157+ AGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGT
                      ____________________________________________________________
consensus             AGGCAGCCCAGAATGAGTGCCAGGTCCTCAAGCTGCTCAACCACCCCAATGTCATTGAGT

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ ACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCG
gi|92212888|gb|DB499+ ACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCG
gi|83048955|gb|DA985+ ACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGACCGCCATGGAATATGCACCAGGCG
gi|67869303|gb|DR157+ ACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCG
                      ____________________________________________________________
consensus             ACTACGAGAACTTCCTGGAAGACAAAGCCCTTATGATCGCCATGGAATATGCACCAGGCG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCC
gi|92212888|gb|DB499+ GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCC
gi|83048955|gb|DA985+ GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCC
gi|67869303|gb|DR157+ GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCC
                      ____________________________________________________________
consensus             GCACTCTGGCTGAGTTCATCCAAAAGCGCTGTAATTCCCTGCTGGAGGAGGAGACCATCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ TGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGC
gi|92212888|gb|DB499+ TGCACTTCTTCGTGCAGATCCTGCTCGCACTGCATCATGTGCACACCCACCTCATCCTGC
gi|83048955|gb|DA985+ TGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGC
gi|67869303|gb|DR157+ TGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGC
                      ____________________________________________________________
consensus             TGCACTTCTTCGTGCAGATCCTGCTTGCACTGCATCATGTGCACACCCACCTCATCCTGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG
gi|92212888|gb|DB499+ ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCGTGGTCGTCAAGATCG
gi|83048955|gb|DA985+ ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG
gi|67869303|gb|DR157+ ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG
gi|13287774|gb|BG394+  CCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG
gi|10398276|gb|BE905+                                             ATGGTCGTCAAGATCG
gi|13136344|gb|BG329+  CCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG
                      ____________________________________________________________
consensus             ACCGAGACCTCAAGACCCAGAACATCCTGCTTGACAAACACCGCATGGTCGTCAAGATCG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|51661225|gb|CR747+ GTGATTTCGGCATCTCCA                                          
gi|92212888|gb|DB499+ GTGATTTCGGCATCTCCAA                                         
gi|83048955|gb|DA985+ GTGATTTTGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCCTACACGGTGGTGGGTA
gi|67869303|gb|DR157+ GTGATTTCGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCCTACACGGTGGTGGGTA
gi|13287774|gb|BG394+ GTGATTTCGGCATCTCCAAGATCCTTAGCATCAAGAGCAAGGCCTACACGGTGGTGGGTA
gi|10398276|gb|BE905+ GTGATTTCGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCCTACACGGTGGTGGGTA
gi|13136344|gb|BG329+ GTGATTTCGGCATCTCCAAGATCCTTAGCATCAAGAGCAAGGCCTACACGGTGGTGGGTA
                      ____________________________________________________________
consensus             GTGATTTCGGCATCTCCAAGATCCTTAGCAGCAAGAGCAAGGCCTACACGGTGGTGGGTA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|83048955|gb|DA985+ CCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACA
gi|67869303|gb|DR157+ CGCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCGGAAGAGTGACA
gi|13287774|gb|BG394+ CCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACA
gi|10398276|gb|BE905+ CCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACA
gi|13136344|gb|BG329+ CCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACA
                      ____________________________________________________________
consensus             CCCCATGCTATATCTCCCCTGAGCTGTGTGAGGGCAAGCCCTACAACCAGAAGAGTGACA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|83048955|gb|DA985+ TCT                                                         
gi|67869303|gb|DR157+ TCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGC  
gi|13287774|gb|BG394+ TCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGCTG
gi|10398276|gb|BE905+ TCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGCTG
gi|13136344|gb|BG329+ TCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGCTG
                      ____________________________________________________________
consensus             TCTGGGCCCTGGGCTGTGTCCTCTACGAGCTGGCCAGCCTCAAGAGGGCTTTCGAGGCTG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ CGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCTATCTCTGACC
gi|10398276|gb|BE905+ CGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCTATCTCTGACC
gi|13136344|gb|BG329+ CGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCTATCTCTGACC
                      ____________________________________________________________
consensus             CGAACTTGCCAGCACTGGTGCTGAAGATCATGAGTGGCACCTTTGCACCTATCTCTGACC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGC
gi|10398276|gb|BE905+ GGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGC
gi|13136344|gb|BG329+ GGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGC
                      ____________________________________________________________
consensus             GGTACAGCCCTGAGCTTCGCCAGCTGGTCCTGAGTCTACTCAGCCTGGAGCCTGCCCAGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GGCCACCACTCAGCCACATCATGGCACAGCCCCTCTGCATCCGTGCCCTCCTCAACCTCC
gi|10398276|gb|BE905+ GGCCACCACTCAGCCACATCATGGCACAGCCCCTCTGCATCCGTGCCCTCCTCAACCTCC
gi|13136344|gb|BG329+ GGGCACCACTCAGCCACATCATGGCACAGACCCTCTGCATCCGTGCCCTCCTCAACCTCC
                      ____________________________________________________________
consensus             GGCCACCACTCAGCCACATCATGGCACAGCCCCTCTGCATCCGTGCCCTCCTCAACCTCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ ACACCGACGTGGGCAGTGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACA
gi|10398276|gb|BE905+ ACACCGACGTGGGCAGTGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACA
gi|13136344|gb|BG329+ ACACCGACGTGGGCAGAGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACA
                      ____________________________________________________________
consensus             ACACCGACGTGGGCAGTGTCCGCATGCGGAGGGCAGAGAAGTCCGTGGCCCCCAGCAACA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ CAGGGAGCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAG
gi|10398276|gb|BE905+ CAGGGAGCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAG
gi|13136344|gb|BG329+ CAGGGAGCAGGACCAACAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAG
                      ____________________________________________________________
consensus             CAGGGAGCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ CCATCCCAACAC-ACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTTGGGCGGCCCCCAT
gi|10398276|gb|BE905+ C-ATCCCACCACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCT-GGGCACCCCCC-T
gi|13136344|gb|BG329+ CCATCCCAACAACACTGTCGTCAGTGTATGCCTGGGGAGGTGGGCT              
                      ____________________________________________________________
consensus             CCATCCCAACACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTTGGGCACCCCCCAT

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GGGGATGCCAAT-GCTCAACACAGAGGTGGTCCAGGTCGGCAGTGGGGCGCGCGCAGAAG
gi|10398276|gb|BE905+ GCGGCTGCCAATAGCTCAACACAGAGGTGGTCCAGGT                       
                      ____________________________________________________________
consensus             GCGGATGCCAATAGCTCAACACAGAGGTGGTCCAGGTCGGCAGTGGGGCGCGCGCAGAAG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GCGGCGTCACGCGCTACTGGGAGGTCTCAACCTGTGAGCAGGACCAACCCCTAAGTGCAA
                      ____________________________________________________________
consensus             GCGGCGTCACGCGCTACTGGGAGGTCTCAACCTGTGAGCAGGACCAACCCCTAAGTGCAA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GACGACGCAGACAACCATACTGAGGCACATGGAGCAGCCAAAGCCCAGATTCAACCGACG
                      ____________________________________________________________
consensus             GACGACGCAGACAACCATACTGAGGCACATGGAGCAGCCAAAGCCCAGATTCAACCGACG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ AACCAGGGAAGACCAGAACGGGGTGACAATAAAGACGGTCGACAGTGGGGAACCACAACA
                      ____________________________________________________________
consensus             AACCAGGGAAGACCAGAACGGGGTGACAATAAAGACGGTCGACAGTGGGGAACCACAACA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ CGACGGGCCGAAGGAAAACAAGCACACACCCAAGACAAATCGCGAAGCGACAAACAGGGG
                      ____________________________________________________________
consensus             CGACGGGCCGAAGGAAAACAAGCACACACCCAAGACAAATCGCGAAGCGACAAACAGGGG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GCCAAAGCACGGCGGCAGCCCCTGAAAACACGAGCCAACACAGGGGACGCGCAACCGCGA
                      ____________________________________________________________
consensus             GCCAAAGCACGGCGGCAGCCCCTGAAAACACGAGCCAACACAGGGGACGCGCAACCGCGA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ CAAAACAGGTACACCCCGTACAAGCAACACCGAAGAAACCGATAGAGAAACAACCAATAC
                      ____________________________________________________________
consensus             CAAAACAGGTACACCCCGTACAAGCAACACCGAAGAAACCGATAGAGAAACAACCAATAC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|13287774|gb|BG394+ GACGACCAACCAGACAGGGTGAAGAGGCAACAACACACCAGAGAC
                      ____________________________________________________________
consensus             GACGACCAACCAGACAGGGTGAAGAGGCAACAACACACCAGAGAC

******************* Contig 2 ********************
                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ TGAGGGCAGCCCTACACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGC
                      ____________________________________________________________
consensus             TGAGGGCAGCCCTACACCAGAAGAGTGACATCTGGGCCCTGGGCTGTGTCCTCTACGAGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ TGGCCAGCCTCAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCACTGGTGCTGAAGATCA
                      ____________________________________________________________
consensus             TGGCCAGCCTCAAGAGGGCTTTCGAGGCTGCGAACTTGCCAGCACTGGTGCTGAAGATCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ TGAGTGGCACCTTTGCACCTATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGCTGGTCC
                      ____________________________________________________________
consensus             TGAGTGGCACCTTTGCACCTATCTCTGACCGGTACAGCCCTGAGCTTCGCCAGCTGGTCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ TGAGTCTACTCAGCCTGGAGCCTGCCCAGCGGCCACCACTCAGCCACATCATGGCACAGC
                      ____________________________________________________________
consensus             TGAGTCTACTCAGCCTGGAGCCTGCCCAGCGGCCACCACTCAGCCACATCATGGCACAGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ CCCTCTGCATCTGTGCCCTCCTCAACCTCCACACCGACGTGGGCAGTGTCCGCATGCGGA
                      ____________________________________________________________
consensus             CCCTCTGCATCTGTGCCCTCCTCAACCTCCACACCGACGTGGGCAGTGTCCGCATGCGGA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ GGCCTGTGCAGGGACAGCGAGCGGTCCTGGGCGGCAGGGTGTGGGCACCCAGTGGGAGCA
                      ____________________________________________________________
consensus             GGCCTGTGCAGGGACAGCGAGCGGTCCTGGGCGGCAGGGTGTGGGCACCCAGTGGGAGCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ CAGGAGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGA
gi|46566216|gb|CN484+                        AGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGA
                      ____________________________________________________________
consensus             CAGGAGGCCCCCATCTGTCCTGCAGGGCAGAGAAGTCCGTGGCCCCCAGCAACACAGGGA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ GCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCC
gi|46566216|gb|CN484+ GCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCC
                      ____________________________________________________________
consensus             GCAGGACCACCAGTGTCCGCTGCAGAGGTATCCCCCGGGGACCTGTGAGGCCAGCCATCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ CACCACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTGC
gi|46566216|gb|CN484+ CACCACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTGC
                      ____________________________________________________________
consensus             CACCACCACTGTCGTCAGTGTATGCCTGGGGTGGTGGGCTGGGCACCCCCCTGCGGCTGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ CAATGCTCAACACAGAGGTGGTCCAGGTGGCAGCTGGGCGCACGCAGAAAGCCGGCGTCA
gi|46566216|gb|CN484+ CAATGCTCAACACAGAGGTGGTCCAGGTGGCAGCTGGGCGCACGCAGAAAGCCGGCGTCA
gi|66264939|gb|DR005+                           GTGGCAGCTGGGCGCACGCANAA-GCCGGCGTCA
                      ____________________________________________________________
consensus             CAATGCTCAACACAGAGGTGGTCCAGGTGGCAGCTGGGCGCACGCAGAAAGCCGGCGTCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ CGCGCTCTGGGCGTCTCATCCTGTGGGAGGCCCCACCCCTAGGTGCAGGCGGAGGCAGTC
gi|46566216|gb|CN484+ CGCGCTCTGGGCGTCTCATCCTGTGGGAGGCCCCACCCCTAGGTGCAGGCGGAGGCAGTC
gi|66264939|gb|DR005+ CGCGCTCTGGGCGTCTCATCCTGTGGGAGGCCCCACCC-TAG-TGCAGGCGGAGGCAGTC
                      ____________________________________________________________
consensus             CGCGCTCTGGGCGTCTCATCCTGTGGGAGGCCCCACCCCTAGGTGCAGGCGGAGGCAGTC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ TCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCATCTCGCGTTTCCTGGAGGGCC
gi|46566216|gb|CN484+ TCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCATCTCGCGTTTCCTGGAGGGCC
gi|66264939|gb|DR005+ TCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCATCTCGCGTTTCCTGGAGGGCC
                      ____________________________________________________________
consensus             TCCTTCCTGGGGCAGTGGAGCAGCCACAGCCCCAGTTCATCTCGCGTTTCCTGGAGGGCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ AGTCGGGTGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCCTGCCTGACTG
gi|46566216|gb|CN484+ AGTCGGGCGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCCTGCCTGACTG
gi|66264939|gb|DR005+ AGTCGGGTGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCCTGCCTGACTG
gi|12100343|gb|BF795+                                                        GACTG
                      ____________________________________________________________
consensus             AGTCGGGTGTGACCATCAAGCACGTGGCCTGTGGGGACTTCTTCACTGCCTGCCTGACTG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|71054955|gb|DR762+ AC                                                         
gi|46566216|gb|CN484+ ACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCC
gi|66264939|gb|DR005+ ACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCC
gi|12100343|gb|BF795+ ACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCC
                      ____________________________________________________________
consensus             ACAGAGGCATCATCATGACATTCGGCAGCGGCAGCAATGGGTGCCTAGGCCATGGCAGCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|46566216|gb|CN484+ TCACTGACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG
gi|66264939|gb|DR005+ TCACTGACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG
gi|12100343|gb|BF795+ TCACTGACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG
gi|14066133|gb|BG755+                      CCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG
gi|28848021|gb|BX283+                      CCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG
                      ____________________________________________________________
consensus             TCACTGACATCAGCCAGCCCACCATTGTGGAGGCTTTGCTGGGCTATGAAATGGTGCAGG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|46566216|gb|CN484+ TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGA               
gi|66264939|gb|DR005+ TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG
gi|12100343|gb|BF795+ TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG
gi|68280018|gb|CR986+                      TGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG
gi|14066133|gb|BG755+ TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG
gi|28848021|gb|BX283+ TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG
                      ____________________________________________________________
consensus             TGGCCTGTGGGGCCTCTCACGTGCTGGCCCTGTCCACTGAGCGAGAACTATTTGCCTGGG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC
gi|12100343|gb|BF795+ GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC
gi|68280018|gb|CR986+ GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC
gi|14066133|gb|BG755+ GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC
gi|2007915|gb|AA3555+                                           CCCACAGCTGCCCCCAGC
gi|28848021|gb|BX283+ GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC
                      ____________________________________________________________
consensus             GCCGTGGAGACAGCGGCAGACTGGGGCTAGGCACCAGGGAGTCCCACAGCTGCCCCCAGC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
gi|12100343|gb|BF795+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
gi|68280018|gb|CR986+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
gi|14066133|gb|BG755+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
gi|2007915|gb|AA3555+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
gi|28848021|gb|BX283+ AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA
                      ____________________________________________________________
consensus             AGGTGCCCATGCCCCCAGGACAGGAAGCTCAGCGAGTTGTATGTGGTATCGATTCCTCCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
gi|12100343|gb|BF795+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
gi|68280018|gb|CR986+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
gi|14066133|gb|BG755+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
gi|2007915|gb|AA3555+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
gi|28848021|gb|BX283+ TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG
                      ____________________________________________________________
consensus             TGATCCTCACTGTGCCTGGCCAAGCCCTAGCCTGTGGGAGCAACAGGTTCAACAAGCTGG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
gi|12100343|gb|BF795+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
gi|68280018|gb|CR986+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
gi|14066133|gb|BG755+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
gi|2007915|gb|AA3555+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
gi|28848021|gb|BX283+ GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC
                      ____________________________________________________________
consensus             GCCTGGACCACCTCTCCCTGGGGGAGGAGCCTGTCCCCCACCAGCAAGTGGAGGAGGCCC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
gi|12100343|gb|BF795+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
gi|68280018|gb|CR986+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
gi|14066133|gb|BG755+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
gi|2007915|gb|AA3555+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
gi|28848021|gb|BX283+ TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC
                      ____________________________________________________________
consensus             TGAGCTTCACACTACTAGGCTCTGCACCCCTGGACCAGGAGCCTCTGCTGAGTATAGACC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG
gi|12100343|gb|BF795+ TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG
gi|68280018|gb|CR986+ TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG
gi|14066133|gb|BG755+ TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG
gi|2007915|gb|AA3555+ TGGGCACTGCTCACTCAGCTGNTGTGACTGCCTCGGGTGATTNCTACAACTTTTTGGCAG
gi|28848021|gb|BX283+ TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG
                      ____________________________________________________________
consensus             TGGGCACTGCTCACTCAGCTGCTGTGACTGCCTCGGGTGATTGCTACAC--TTTTGGCAG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ CAATCAGCA-CGGACAGTT-GGGCACCCATACTCGCCGAGGCAGTCGGGCACCCTGTAAG
gi|12100343|gb|BF795+ CAATCAGCA-CGGACAGTT-GGGCACCAATACTCGCCGAGGCAGTCGGGCACC-TGTAAG
gi|68280018|gb|CR986+ CAATCANCA-CGGACAGTT-GGGCACCAATACTCGCCGAGGCAGTCGGGCACCCTGTAAG
gi|14066133|gb|BG755+ CAATCAGCA-CGGACAGTT-GGGCACCAATACTCGCCGAGGCAGTCGGGCACCCTGTAAG
gi|2007915|gb|AA3555+ CAATNAGCAACGGACAGTTTGGGCACCAAT                              
gi|28848021|gb|BX283+ CAATCAGCA-CGGACAGTT-GGGCACCAATACTCGCCGAGGCAGTCGGGCA         
                      ____________________________________________________________
consensus             CAATCAGCA-CGGACAGTT-GGGCACCAATACTCGCCGAGGCAGTCGGGCACCCTGTAAG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|66264939|gb|DR005+ GTCCAAGGCCTTGAGGGCATCAAG                                    
gi|12100343|gb|BF795+ GTCCACGGCCTTGAGGGCATCAAGATGGCAATGGTAGC-TGTGGGGATGCCTTCCCTGTA
gi|68280018|gb|CR986+ GTCCAAGGCCTTGAGGGCATCAAGATGGCAATGGTAGCCTGTGGGGATGCCTTCACTGTA
gi|14066133|gb|BG755+ GTCCAAGGCCTTGAGGGCATCAAGATGGCAATGGTAGCCTGTGGGGATGCCTTCACTGTA
                      ____________________________________________________________
consensus             GTCCAAGGCCTTGAGGGCATCAAGATGGCAATGGTAGCCTGTGGGGATGCCTTCACTGTA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ GCTAT-GGGGCAGAGAGCGAAGTGTACTCTTAGGGGGAAACGGGGCGCGAAGGTCAATTG
gi|68280018|gb|CR986+ GCTATTGGGGCAGAGAGCGAAGTGTACTCTT                             
gi|14066133|gb|BG755+ GCTATTGGGGCAGAGAGCGAAGTGTACTCTT                             
                      ____________________________________________________________
consensus             GCTATTGGGGCAGAGAGCGAAGTGTACTCTTAGGGGGAAACGGGGCGCGAAGGTCAATTG

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ GGAACGCACGGGCTCCGCTGCCGGACTCCTCGCCAGCGCAGTGGATGAGGCACACCTTAC
                      ____________________________________________________________
consensus             GGAACGCACGGGCTCCGCTGCCGGACTCCTCGCCAGCGCAGTGGATGAGGCACACCTTAC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ ACGGTGACTCCGGGCCCGGTGGCATGGAAGACCCCACGGAGGTCACACGGGCCACAGAGT
                      ____________________________________________________________
consensus             ACGGTGACTCCGGGCCCGGTGGCATGGAAGACCCCACGGAGGTCACACGGGCCACAGAGT

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ AAGCGGCCCCCTAGGAACCGGAGTGTACCACTGGGACACCCGGAGAATGGCTACTGCACA
                      ____________________________________________________________
consensus             AAGCGGCCCCCTAGGAACCGGAGTGTACCACTGGGACACCCGGAGAATGGCTACTGCACA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ CAAAGCGCGTGAACGAGGCGACGGACAAGGGCGAACTAGCTAAGATCCGAACGAGCACAC
                      ____________________________________________________________
consensus             CAAAGCGCGTGAACGAGGCGACGGACAAGGGCGAACTAGCTAAGATCCGAACGAGCACAC

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ AAGCGACAGAGGAGGACACCCAGAGCTACAGCCAGTAGCACCACACAGCTCCACAACGCA
                      ____________________________________________________________
consensus             AAGCGACAGAGGAGGACACCCAGAGCTACAGCCAGTAGCACCACACAGCTCCACAACGCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ ACAACCTTCAAGAAAGAAGAACACGTAAGAACAAACAACAACGCCACAAAAGAGCGACCA
                      ____________________________________________________________
consensus             ACAACCTTCAAGAAAGAAGAACACGTAAGAACAAACAACAACGCCACAAAAGAGCGACCA

                          .    :    .    :    .    :    .    :    .    :    .    :
gi|12100343|gb|BF795+ CAAGTAGTGGGCGTGTCTAGCCGCTATTCACACAAAACAGAAAC
                      ____________________________________________________________
consensus             CAAGTAGTGGGCGTGTCTAGCCGCTATTCACACAAAACAGAAAC
发表于 2011-4-20 15:47:33 | 显示全部楼层
1# gongyonghui2
生成的contigs就是一些短的拼接文件
cap默认的保存文件以.out结束
consensus是一些保守序列
发表于 2011-6-15 11:03:12 | 显示全部楼层
cap3 sequence.fa -a ** -b ** -c ** ...... > out.txt
我输入以上口令怎没还是不能运行?拜托各位教小弟下,谢谢!
您需要登录后才可以回帖 登录 | 注册

本版积分规则

QQ|申请友链|小黑屋|手机版|Archiver|生物信息学论坛 ( 蜀ICP备09031721号  

GMT+8, 2017-1-21 12:31 , Processed in 0.119308 second(s), 21 queries .

Powered by Discuz! X3

© 2001-2013 Comsenz Inc.

快速回复 返回顶部 返回列表